The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0144
Genome IDCP000682
Search identical group
Phylum/ClassThermoproteota
SpeciesMetallosphaera sedula DSM 5348 [CP000682]
Start position on genome 40090
End posion on genome 40185
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
cttcaaaggt
tRNA gene sequence
GCCGGGGTGCCCGAGCGGACCAAGGGGCTGGCCTGGAGAGCCAGTAGGGGCAACCCTACG
CGGGTTCAAATCCCGCCCCCGGCGcgt
Downstream region at tRNA end position
taggtgattt
Secondary structure (Cloverleaf model)
>At0144	Ser	GGA
                   t      Gcgt taggtgattt
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C G C C C     A
      C G A        G      | | | | |     A
    G       G C C C       G C G G G     C
    G         | | |                 T T
    A       A G G G
      C C A        G     TAGGGGCAACCCTAC
                    C - G
                    T - A
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G *
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGCCCGAGCGGACCAAGGGGCTGGCCTGGAGaatgttccggctAGCCAGTAGG
GGCAACCCTACGCGGGTTCAAATCCCGCCCCCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK