The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0148
Genome IDCP000682
Search identical group
Phylum/ClassThermoproteota
SpeciesMetallosphaera sedula DSM 5348 [CP000682]
Start position on genome 142554
End posion on genome 142627
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tgtatgacgg
tRNA gene sequence
GGGCCCGTAGCTCAGCTAGGTAGAGCGGCGGGCTTTTAACCCGTAGGCCCCGGGTTCGAA
TCCCGGCGGGCCCGcta
Downstream region at tRNA end position
catcccccac
Secondary structure (Cloverleaf model)
>At0148	Lys	TTT
                   g      Gcta catcccccac
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     G
    T       C T C G       C C G G G     C
    A       | | | |                 T T
    G       G A G C
      G T A        G     AGGCC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCTAGGTAGAGCGGCGGGCTTTTAACCCGTAGGCCCCGGGTTCGAA
TCCCGGCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK