The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0154
Genome IDCP000682
Search identical group
Phylum/ClassThermoproteota
SpeciesMetallosphaera sedula DSM 5348 [CP000682]
Start position on genome 1542915
End posion on genome 1542988
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
tgatggtggt
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGAAGAGTGCCTGGTTCGCACCCAGGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCAtcc
Downstream region at tRNA end position
tcgctactgc
Secondary structure (Cloverleaf model)
>At0154	Ala	CGC
                   t      Atcc tcgctactgc
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    T       | | | +                 T T
    G       G A G T
      G A A        G     AGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    G - C
                  T       C
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGAAGAGTGCCTGGTTCGCACCCAGGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK