The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0166
Genome IDCP000682
Search identical group
Phylum/ClassThermoproteota
SpeciesMetallosphaera sedula DSM 5348 [CP000682]
Start position on genome 2180910
End posion on genome 2180984
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
cgtctacgtt
tRNA gene sequence
GGGCCCGTCGTCTAGCCTGGTTAGGACGCTGGCCTTACAAGCCAGAGGTCTTGGGTTCAA
ATCCCAACGGGCCCActt
Downstream region at tRNA end position
ttaagatcag
Secondary structure (Cloverleaf model)
>At0166	Val	TAC
                   t      Actt ttaagatcag
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     A A C C C     A
    C C G A        C      | | | | |     A
  T         T C T G       T T G G G     C
  G         + | | |                 T T
  G         G G A C
    T T A          G     AGGTC
                    C - G
                    T - A
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTCGTCTAGCCTGGTTAGGACGCTGGCCTTACAAGCCAGAGGTCTTGGGTTCAA
ATCCCAACGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK