The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0180
Genome IDCP000682
Search identical group
Phylum/ClassThermoproteota
SpeciesMetallosphaera sedula DSM 5348 [CP000682]
Start position on genome 1806889
End posion on genome 1806802
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
ctagatgtag
tRNA gene sequence
GGACCCGTAGCTCAGCCAGGATAGAGCGCCGGCCTTCTAAGCCGAGGGTCGGGGGTCCGA
ATCCCCCCGGGTCCGcat
Downstream region at tRNA end position
tcaaatttta
Secondary structure (Cloverleaf model)
>At0180	Arg	TCT
                   g      Gcat tcaaatttta
                     G - C
                     G - C
                     A - T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C C C C C     A
    C C G A        A      | | | | |     G
  A         C T C G       G G G G G     C
  G         | | | |                 T C
  G         G A G C
    A T A          G     GGGTC
                    C   A
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A *
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGACCCGTAGCTCAGCCAGGATAGAGCGCCGGCCTTCTAacaggccgaagggAGCCGAGG
GTCGGGGGTCCGAATCCCCCCGGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK