The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0197
Genome IDAE009441
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum aerophilum str. IM2 [AE009441]
Start position on genome 1416282
End posion on genome 1416357
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
aaaagaggcg
tRNA gene sequence
AGCCCGGTCGTCTAGCGGCCAAGGATGCGGGGCTTTGGACCCCGTGGCCCGGGTTCGAAT
CCCGGCCGGGCTACCA
Downstream region at tRNA end position
attcatttag
Secondary structure (Cloverleaf model)
>At0197	Gln	TTG
                   g      ACCA attcatttag
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        C      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | +                 T T
    C       G G A T
      C A A        G     TGGC
                    C - G
                    G - C
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCGGTCGTCTAGCGGCCAAGGATGCGGGGCTTTGGACCCCGTGGCCCGGGTTCGAAT
CCCGGCCGGGCTACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK