The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0216
Genome IDAE009441
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum aerophilum str. IM2 [AE009441]
Start position on genome 303676
End posion on genome 303602
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
tacaactacg
tRNA gene sequence
GGGCCGGTAGTCTAGCGGAAGGATGCCCGCCTCGCGCGCGGGAGATCCCGGGTTCGAATC
CCGGCCGGTCCACCA
Downstream region at tRNA end position
gccccttcta
Secondary structure (Cloverleaf model)
>At0216	Ala	CGC
                   g      ACCA gccccttcta
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
        G A        A      | | | | |     G
      C     T C T G       C C G G G     C
      G     + | | +                 T T
      G     G G A T
        A A        G     AGATC
                    C - G
                    C - G
                    C - G
                    G - C
                    C - G
                  C       C
                  T       G
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGTCTAGCGGAAGGATGCCCGCCTCGCGCGCGGGAGATCCCGGGTTCGAATC
CCGGCCGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK