The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0217
Genome IDAE009441
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum aerophilum str. IM2 [AE009441]
Start position on genome 380284
End posion on genome 380200
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
gtgaaaattt
tRNA gene sequence
GCCGGGGTGGCCGAGCGGCCCAAGGCGCGGGACTCGAGATCCCGTCCCCGTCCAGGGGGC
GTGGGTTCAAATCCCACCCCCGGCGcct
Downstream region at tRNA end position
ttcccctttt
Secondary structure (Cloverleaf model)
>At0217	Ser	CGA
                   t      Gcct ttcccctttt
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C A C C C     A
      C G A        G      | | | | |     A
    G       G C C G       G T G G G     C
    G         | | |                 T T
    C       A G G C
      C C A        G     TCCCCGTCCAGGGGGC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGGCCGAGCGGCCCAAGGCGCGGGACTCGAGATCCCGTCCCCGTCCAGGGGGC
GTGGGTTCAAATCCCACCCCCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK