The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0220
Genome IDAE009441
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum aerophilum str. IM2 [AE009441]
Start position on genome 842404
End posion on genome 842327
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tccacccaga
tRNA gene sequence
GGGCCCGTAGCTCAGCCTGGATAGAGCGGCGGCCTTCTAAGCCGTAGGTCGTGGGTTCAA
ATCCCATCGGGCCCGCCA
Downstream region at tRNA end position
taatcctctt
Secondary structure (Cloverleaf model)
>At0220	Arg	TCT
                   a      GCCA taatcctctt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T A C C C     A
    C C G A        A      + | | | |     A
  T         C T C G       G T G G G     C
  G         | | | |                 T T
  G         G A G C
    A T A          G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCTGGATAGAGCGGCGGCCTTCTAAGCCGTAGGTCGTGGGTTCAA
ATCCCATCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK