The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0225
Genome IDAE009441
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum aerophilum str. IM2 [AE009441]
Start position on genome 1226102
End posion on genome 1226004
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
aggctgggga
tRNA gene sequence
GCCCCGGTAGTATAGCCCGGACTAGTATGCGGGCCTGTCGAGCCCGTGACCCGGGTTCAA
ATCCCGGCCGGGGCGCCA
Downstream region at tRNA end position
accctatttt
Secondary structure (Cloverleaf model)
>At0225	Asp	GTC
                   a      GCCA accctatttt
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  C         T A T G       C C G G G     C
  G         + | | +                 T T
  G         G T A T
    A C T A        G     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCacggtacgccgaccgctctagCCGGTAGTATAGCCCGGACTAGTATGCGGGCCTGTC
GAGCCCGTGACCCGGGTTCAAATCCCGGCCGGGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK