The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0233
Genome IDAE009441
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum aerophilum str. IM2 [AE009441]
Start position on genome 1828728
End posion on genome 1828651
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tattgaatca
tRNA gene sequence
GGGCCCGTAGCTCAGCCCGGTTAGAGCGGCGGGCTTTTAACCCGTAGGTCGTGGGTTCGA
ATCCCACCGGGCCCGCCA
Downstream region at tRNA end position
gttagctctt
Secondary structure (Cloverleaf model)
>At0233	Lys	TTT
                   a      GCCA gttagctctt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C A C C C     A
    C C G A        A      | | | | |     G
  C         C T C G       G T G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCCGGTTAGAGCGGCGGGCTTTTAACCCGTAGGTCGTGGGTTCGA
ATCCCACCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK