The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0251
Genome IDCP000660
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum arsenaticum DSM 13514 [CP000660]
Start position on genome 372012
End posion on genome 371935
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tatgtgacaa
tRNA gene sequence
GGGCCCGTAGCTCAGCCTGGATAGAGCGGCGGCCTTCTAAGCCGTAGGTCGTGGGTTCAA
ATCCCATCGGGCCCGCCA
Downstream region at tRNA end position
ttttcctgaa
Secondary structure (Cloverleaf model)
>At0251	Arg	TCT
                   a      GCCA ttttcctgaa
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T A C C C     A
    C C G A        A      + | | | |     A
  T         C T C G       G T G G G     C
  G         | | | |                 T T
  G         G A G C
    A T A          G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCTGGATAGAGCGGCGGCCTTCTAAGCCGTAGGTCGTGGGTTCAA
ATCCCATCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK