The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0262
Genome IDCP000660
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum arsenaticum DSM 13514 [CP000660]
Start position on genome 1346043
End posion on genome 1345971
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
ttgggcggtt
tRNA gene sequence
AGCCCGGTGGTCTAGCGGCCAAGGATGCGGGGCTTTGGACCCCGTGGCCCGGGTTCGAAT
CCCGGCCGGGCTActt
Downstream region at tRNA end position
cttttgaaat
Secondary structure (Cloverleaf model)
>At0262	Gln	TTG
                   t      Actt cttttgaaat
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        G      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | +                 T T
    C       G G A T
      C A A        G     TGGC
                    C - G
                    G - C
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCGGTGGTCTAGCGGCCAAGGATGCGGGGCTTTGGACCCCGTGGCCCGGGTTCGAAT
CCCGGCCGGGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK