The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0273
Genome IDCP000660
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum arsenaticum DSM 13514 [CP000660]
Start position on genome 1695126
End posion on genome 1695029
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
caaatgtaaa
tRNA gene sequence
GGGCCCGTAGTCTAGCGGTTAGGATGCCCGCCTTACACGCGGGTGACCCCGGGTTCGAAT
CCCGGCGGGCCCActc
Downstream region at tRNA end position
ctcttttgag
Secondary structure (Cloverleaf model)
>At0273	Val	TAC
                   a      Actc ctcttttgag
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | +                 T T
    T       G G A T
      T A          G     TGACC
                    C - G
                    C - G
                    C - G
                    G - C
                    C - G
                  C       C
                  T       A *
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGTCTAGCGGTTAGGATGCCCGCCTTACAaggcgcacccgcaacagcctaag
ctCGCGGGTGACCCCGGGTTCGAATCCCGGCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK