The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0281
Genome IDCP000660
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum arsenaticum DSM 13514 [CP000660]
Start position on genome 2095913
End posion on genome 2095791
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
gtaaaaacca
tRNA gene sequence
GCCGGGGTGGCCGAGCGGCCCAAGGCGCGGGACTCGAGATCCCGTCCCCGTCCAGGGGGC
GTGGGTTCAAATCCCACCCCCGGCGCCA
Downstream region at tRNA end position
ctaaacgttt
Secondary structure (Cloverleaf model)
>At0281	Ser	CGA
                   a      GCCA ctaaacgttt
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C A C C C     A
      C G A        G      | | | | |     A
    G       G C C G       G T G G G     C
    G         | | |                 T T
    C       A G G C
      C C A        G     TCCCCGTCCAGGGGGC
                    C - G
                    G - C
                    G - C
                   *G - C
                    A - T
                  C       A
                  T       G
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGGCCGAGCGGCCCAAGGCGCGGGaccgccgtagcggcggcgccaaACTCGAG
gcctaggcaagaaATCCCGTCCCCGTCCAGGGGGCGTGGGTTCAAATCCCACCCCCGGCG
CCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK