The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0298
Genome IDCP000561
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum calidifontis JCM 11548 [CP000561]
Start position on genome 1252620
End posion on genome 1252726
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
cgaggcgttg
tRNA gene sequence
GGGCCGGTAGTCTAGCGGAAGGATGCCCGCCTCGCGCGCGGGTGATCCCGGGTTCGAATC
CCGGCCGGTCCACCA
Downstream region at tRNA end position
tctttctacg
Secondary structure (Cloverleaf model)
>At0298	Ala	CGC
                   g      ACCA tctttctacg
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
        G A        A      | | | | |     G
      C     T C T G       C C G G G     C
      G     + | | +                 T T
      G     G G A T
        A A        G     TGATC
                    C - G
                    C - G
                    C - G
                    G - C
                    C - G
                  C       C
                  T       G
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGTCTAGCGGAAGGATGCCCGCCTCGCGcggctagccccaagaaCGCGGGTG
ATCCCGGGaggggaaccccgggaaTTCGAATCCCGGCCGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK