The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0299
Genome IDCP000561
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum calidifontis JCM 11548 [CP000561]
Start position on genome 1327527
End posion on genome 1327620
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
atcagcggtg
tRNA gene sequence
GGGCCCGTAGCTCAGCCTGGATAGAGCGGCGGCCTTCTAAGCCGTAGGTCGTGGGTTCAA
ATCCCATCGGGCCCGCCA
Downstream region at tRNA end position
cccatcttca
Secondary structure (Cloverleaf model)
>At0299	Arg	TCT
                   g      GCCA cccatcttca
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T A C C C     A
    C C G A        A      + | | | |     A
  T         C T C G       G T G G G     C
  G         | | | |                 T T
  G         G A G C
    A T A          G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCTGGATAGAGCGGCGGCCTTCTAAGCCGTAGGTCGTGGGTTCag
gcaacgccgcccaaAAATCCCATCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK