The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0316
Genome IDCP000561
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum calidifontis JCM 11548 [CP000561]
Start position on genome 914057
End posion on genome 913963
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
agacacgggt
tRNA gene sequence
GGGCCCGTAGCTCAGCCCGGTTAGAGCGGCGGGCTTTTAACCCGTAGGTCGTGGGTTCGA
ATCCCACCGGGCCCGCCA
Downstream region at tRNA end position
cgtcgtcggt
Secondary structure (Cloverleaf model)
>At0316	Lys	TTT
                   t      GCCA cgtcgtcggt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C A C C C     A
    C C G A        A      | | | | |     G
  C         C T C G       G T G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCCGGTTAGAGCGGCGGGCTTTTAACCCGTAGGTCGTGGGTTCag
gcagagccgcctacGAATCCCACCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK