The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0346
Genome IDCP000504
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum islandicum DSM 4184 [CP000504]
Start position on genome 1685379
End posion on genome 1685497
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
ctagacgggg
tRNA gene sequence
GCCCCGGTAGTATAGCCCGGACTAGTATGCGGGCCTGTCGAGCCCGTGACCCGGGTTCAA
ATCCCGGCCGGGGCGCCA
Downstream region at tRNA end position
ttgtctcaac
Secondary structure (Cloverleaf model)
>At0346	Asp	GTC
                   g      GCCA ttgtctcaac
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  C         T A T G       C C G G G     C
  G         + | | +                 T T
  G         G T A T
    A C T A        G     TGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCgtagccagccggctaccccaaCCGGTAGTATAGCCCGGACTAGTATatggccatgtg
ccagctaaaGCGGGCCTGTCGAGCCCGTGACCCGGGTTCAAATCCCGGCCGGGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK