The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0350
Genome IDCP000504
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum islandicum DSM 4184 [CP000504]
Start position on genome 118901
End posion on genome 118830
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
ttgcaaaaca
tRNA gene sequence
GGGCCGGTAGTCTAGCGGAAGGATGCCCGCCTCGCGCGCGGGTGATCCCGGGTTCGAATC
CCGGCCGGTCCActa
Downstream region at tRNA end position
attttaaaaa
Secondary structure (Cloverleaf model)
>At0350	Ala	CGC
                   a      Acta attttaaaaa
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
        G A        A      | | | | |     G
      C     T C T G       C C G G G     C
      G     + | | +                 T T
      G     G G A T
        A A        G     TGATC
                    C - G
                    C - G
                    C - G
                    G - C
                    C - G
                  C       C
                  T       G
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGTCTAGCGGAAGGATGCCCGCCTCGCGCGCGGGTGATCCCGGGTTCGAATC
CCGGCCGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK