The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0396
Genome IDCP000575
Search identical group
Phylum/ClassThermoproteota
SpeciesStaphylothermus marinus F1 [CP000575]
Start position on genome 1056248
End posion on genome 1056322
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
aataatactt
tRNA gene sequence
GGGCCCGTGGCCTAGCCTGGATAGGGCGCCGGCCTTCTAAGCCGGAGACCCGGGGTTCGA
ATCCCCGCGGGCCCGcat
Downstream region at tRNA end position
ttctattatg
Secondary structure (Cloverleaf model)
>At0396	Arg	TCT
                   t      Gcat ttctattatg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G C C C C     A
    C C G A        G      | | | | |     G
  T         T C C G       C G G G G     C
  G         + | | |                 T T
  G         G G G C
    A T A          G     AGACC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGCCTAGCCTGGATAGGGCGCCGGCCTTCTAAGCCGGAGACCCGGGGTTCGA
ATCCCCGCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK