The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0419
Genome IDCP000575
Search identical group
Phylum/ClassThermoproteota
SpeciesStaphylothermus marinus F1 [CP000575]
Start position on genome 1415757
End posion on genome 1415658
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
attatggtgt
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGAAGAGCGCCGCCCTCGCAAGGCGGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCACCA
Downstream region at tRNA end position
tctacataaa
Secondary structure (Cloverleaf model)
>At0419	Ala	CGC
                   t      ACCA tctacataaa
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    T       | | | |                 T T
    G       G A G C
      G A A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A *
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGAAGAGCGCCGCCCTCGCAtataatgctaccgaggtcgggg
gAGGCGGAGGTCCCGGGTTCAAATCCCGGCCGGTCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK