The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0430
Genome IDCP000077
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfolobus acidocaldarius DSM 639 [CP000077]
Start position on genome 608757
End posion on genome 608852
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
atttttagct
tRNA gene sequence
GGGCCCGTAGCTCAGCCAGGTAGAGCGGCGGGCTTTTAACCCGTAGGTCCCGGGTTCAAA
TCCCGGCGGGCCCGcgc
Downstream region at tRNA end position
tattttgtat
Secondary structure (Cloverleaf model)
>At0430	Lys	TTT
                   t      Gcgc tattttgtat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    A       | | | |                 T T
    G       G A G C
      G T A        G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A *
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCAGGTAGAGCGGCGGGCTTTTAaccgcgggtcgcgcgggaagcg
ACCCGTAGGTCCCGGGTTCAAATCCCGGCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK