The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0439
Genome IDCP000077
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfolobus acidocaldarius DSM 639 [CP000077]
Start position on genome 2207779
End posion on genome 2207852
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
tagatttcat
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGAAGAGTGCTTGGCTCGCACCCAAGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCAcat
Downstream region at tRNA end position
ttattaaatg
Secondary structure (Cloverleaf model)
>At0439	Ala	CGC
                   t      Acat ttattaaatg
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    T       | | | +                 T T
    G       G A G T
      G A A        G     AGGTC
                    C - G
                    T - A
                    T - A
                    G - C
                    G - C
                  C       C
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGAAGAGTGCTTGGCTCGCACCCAAGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK