The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0450
Genome IDCP000077
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfolobus acidocaldarius DSM 639 [CP000077]
Start position on genome 507601
End posion on genome 507527
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
aatagcttga
tRNA gene sequence
GGGCCCGTCGTCTAGCCTGGTTAGGACGTCGCCCTTACAAGGCGGAGGTCCTGGGTTCAA
ATCCCAGCGGGCCCAtac
Downstream region at tRNA end position
ttttacatta
Secondary structure (Cloverleaf model)
>At0450	Val	TAC
                   a      Atac ttttacatta
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G A C C C     A
    C C G A        C      | | | | |     A
  T         T C T G       C T G G G     C
  G         + | | |                 T T
  G         G G A C
    T T A          G     AGGTC
                    T + G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTCGTCTAGCCTGGTTAGGACGTCGCCCTTACAAGGCGGAGGTCCTGGGTTCAA
ATCCCAGCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK