The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0452
Genome IDCP000077
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfolobus acidocaldarius DSM 639 [CP000077]
Start position on genome 542643
End posion on genome 542559
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
tcttattaat
tRNA gene sequence
GCCGGGGTGCCCGAGTGGACTAAGGGGCTGGCCTGGAGAGCCAGTGTGGATCTTCCACGC
GCGGGTTCAAATCCCGCCCCCGGCGtag
Downstream region at tRNA end position
tgggggattt
Secondary structure (Cloverleaf model)
>At0452	Ser	GGA
                   t      Gtag tgggggattt
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C G C C C     A
      T G A        G      | | | | |     A
    G       G C C C       G C G G G     C
    G         | | |                 T T
    A       A G G G
      C T A        G     TGTGGATCTTCCACGC
                    C - G
                    T - A
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    G G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGCCCGAGTGGACTAAGGGGCTGGCCTGGAGAGCCAGTGTGGATCTTCCACGC
GCGGGTTCAAATCCCGCCCCCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK