The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0463
Genome IDCP000077
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfolobus acidocaldarius DSM 639 [CP000077]
Start position on genome 1240470
End posion on genome 1240398
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
aagtatactt
tRNA gene sequence
AGCCGGGTCGTCTAGCGGTCAAGGATCCAGGGCTTTGGCCCCTGGGACCAGGGTTCGAGT
CCCTGCCCGGCTAcct
Downstream region at tRNA end position
tattggggta
Secondary structure (Cloverleaf model)
>At0463	Gln	TTG
                   t      Acct tattggggta
                     A - T
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C          T G
                    T     G T C C C     A
      C G A        C      | | | | |     G
    G       T C T G       C A G G G     C
    G       + | | +                 T T
    T       G G A T
      C A A        C     GGAC
                    C - G
                    A - T
                    G - C
                    G - C
                    G - C
                  C       C
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCGGGTCGTCTAGCGGTCAAGGATCCAGGGCTTTGGCCCCTGGGACCAGGGTTCGAGT
CCCTGCCCGGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK