The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0475
Genome IDAE006641
Search identical group
Phylum/ClassThermoproteota
SpeciesSaccharolobus solfataricus P2 [AE006641]
Start position on genome 386883
End posion on genome 386955
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gtatagaatt
tRNA gene sequence
AGCCGGGTAGTCTAGTGGTCAAGGATCCAGGGCTTTGGCCCCTGGGACCAGGGTTCGAAT
CCCTGCCCGGCTAcct
Downstream region at tRNA end position
ctcggctaat
Secondary structure (Cloverleaf model)
>At0475	Gln	TTG
                   t      Acct ctcggctaat
                     A - T
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C          T A
                    T     G T C C C     A
      T G A        A      | | | | |     G
    G       T C T G       C A G G G     C
    G       + | | +                 T T
    T       G G A T
      C A A        C     GGAC
                    C - G
                    A - T
                    G - C
                    G - C
                    G - C
                  C       C
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCGGGTAGTCTAGTGGTCAAGGATCCAGGGCTTTGGCCCCTGGGACCAGGGTTCGAAT
CCCTGCCCGGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK