The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0481
Genome IDAE006641
Search identical group
Phylum/ClassThermoproteota
SpeciesSaccharolobus solfataricus P2 [AE006641]
Start position on genome 646823
End posion on genome 646897
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
aataactagt
tRNA gene sequence
GGGCCCGTCGTCTAGCCTGGTTAGGACGCTGCCCTTACGAGGCAGAGGTCCTGGGTTCAA
ATCCCAGCGGGCCCAttg
Downstream region at tRNA end position
tgggggatac
Secondary structure (Cloverleaf model)
>At0481	Val	TAC
                   t      Attg tgggggatac
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G A C C C     A
    C C G A        C      | | | | |     A
  T         T C T G       C T G G G     C
  G         + | | |                 T T
  G         G G A C
    T T A          G     AGGTC
                    C - G
                    T - A
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTCGTCTAGCCTGGTTAGGACGCTGCCCTTACGAGGCAGAGGTCCTGGGTTCAA
ATCCCAGCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK