The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0485
Genome IDAE006641
Search identical group
Phylum/ClassThermoproteota
SpeciesSaccharolobus solfataricus P2 [AE006641]
Start position on genome 915708
End posion on genome 915781
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
tttaattagt
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGAAGAGTGCTCGGTTCGCACCCGAGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCAtta
Downstream region at tRNA end position
ttatgatgac
Secondary structure (Cloverleaf model)
>At0485	Ala	CGC
                   t      Atta ttatgatgac
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    T       | | | +                 T T
    G       G A G T
      G A A        G     AGGTC
                    C - G
                    T - A
                    C - G
                    G - C
                    G - C
                  T       C
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGAAGAGTGCTCGGTTCGCACCCGAGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK