The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0489
Genome IDAE006641
Search identical group
Phylum/ClassThermoproteota
SpeciesSaccharolobus solfataricus P2 [AE006641]
Start position on genome 122655
End posion on genome 122559
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
acttacgttt
tRNA gene sequence
GGGCCCGTAGCTCAGCCAGGTAGAGCGGCGGGCTTTTAACCCGTAGGTCCCGGGTTCGAA
TCCCGGCGGGCCCGcgc
Downstream region at tRNA end position
actatttctt
Secondary structure (Cloverleaf model)
>At0489	Lys	TTT
                   t      Gcgc actatttctt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     G
    C       C T C G       C C G G G     C
    A       | | | |                 T T
    G       G A G C
      G T A        G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A *
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCAGGTAGAGCGGCGGGCTTTTAaccgcaaagggttgcggaaagc
aACCCGTAGGTCCCGGGTTCGAATCCCGGCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK