The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0532
Genome IDBA000023
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfurisphaera tokodaii str. 7 [BA000023]
Start position on genome 1366019
End posion on genome 1366091
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
tattattatt
tRNA gene sequence
AGCCGGGTCGTCTAGTGGTCAAGGATCGAGGGCTTTGGCCCCTCGGACCTGGGTTCAAAT
CCCAGCCCGGCTAcct
Downstream region at tRNA end position
ttttataaaa
Secondary structure (Cloverleaf model)
>At0532	Gln	TTG
                   t      Acct ttttataaaa
                     A - T
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C          T A
                    T     G A C C C     A
      T G A        C      | | | | |     A
    G       T C T G       C T G G G     C
    G       + | | +                 T T
    T       G G A T
      C A A        C     GGAC
                    G - C
                    A - T
                    G - C
                    G - C
                    G - C
                  C       C
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCGGGTCGTCTAGTGGTCAAGGATCGAGGGCTTTGGCCCCTCGGACCTGGGTTCAAAT
CCCAGCCCGGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK