The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0537
Genome IDBA000023
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfurisphaera tokodaii str. 7 [BA000023]
Start position on genome 2190961
End posion on genome 2191034
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
gcgggcccat
tRNA gene sequence
GGGCCGGTAGCTCAGCCTGGAAGAGTGCTCGGCTCGCACCCGAGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCActc
Downstream region at tRNA end position
ttagtattga
Secondary structure (Cloverleaf model)
>At0537	Ala	CGC
                   t      Actc ttagtattga
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    T       | | | +                 T T
    G       G A G T
      G A A        G     AGGTC
                    C - G
                    T - A
                    C - G
                    G - C
                    G - C
                  C       C
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTAGCTCAGCCTGGAAGAGTGCTCGGCTCGCACCCGAGAGGTCCCGGGTTCAAA
TCCCGGCCGGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK