The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0539
Genome IDBA000023
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfurisphaera tokodaii str. 7 [BA000023]
Start position on genome 2270483
End posion on genome 2270573
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tagaatctgt
tRNA gene sequence
GGACCCGTAGCTCAGCCAGGATAGAGCGCCGGCCTTCTAAGCCGGTGGTCCCGGGTTCAA
ATCCCGGCGGGTCCGcta
Downstream region at tRNA end position
tactttttat
Secondary structure (Cloverleaf model)
>At0539	Arg	TCT
                   t      Gcta tactttttat
                     G - C
                     G - C
                     A - T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  A         C T C G       C C G G G     C
  G         | | | |                 T T
  G         G A G C
    A T A          G     TGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A *
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGACCCGTAGCTCAGCCAGGATAGAGCGCCGGCCTTCTAtgtgaaggccgaagtgAGCCG
GTGGTCCCGGGTTCAAATCCCGGCGGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK