The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0542
Genome IDBA000023
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfurisphaera tokodaii str. 7 [BA000023]
Start position on genome 208281
End posion on genome 208183
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tcatttttgt
tRNA gene sequence
GGGCCCGTAGCTCAGCCAGGTAGAGCGGCGGGCTTTTAACCCGTAGGTCCCGGGTTCAAA
TCCCGGCGGGCCCGcgt
Downstream region at tRNA end position
attatttttg
Secondary structure (Cloverleaf model)
>At0542	Lys	TTT
                   t      Gcgt attatttttg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        A      | | | | |     A
    C       C T C G       C C G G G     C
    A       | | | |                 T T
    G       G A G C
      G T A        G     AGGTC
                    G + T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A *
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCTCAGCCAGGTAGAGCGGCGGGCTTTTAaccgcgtaacgggttgcgggaa
gcaACCCGTAGGTCCCGGGTTCAAATCCCGGCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK