The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0571
Genome IDCP000505
Search identical group
Phylum/ClassThermoproteota
SpeciesThermofilum pendens Hrk 5 [CP000505]
Start position on genome 462671
End posion on genome 462800
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
aagactagca
tRNA gene sequence
GGGCCCGTAGTCTAGTGGTTAGGATGCCGCCCTTACACGGCGGTGGTCCCGGGTTCGAAT
CCCGGCGGGCCCACCA
Downstream region at tRNA end position
attttctgcg
Secondary structure (Cloverleaf model)
>At0571	Val	TAC
                   a      ACCA attttctgcg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      T G A        A      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | +                 T T
    T       G G A T
      T A          G     TGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGTCTAGTGGTTAGGATtcgtgtgcacgtgcacacgactgaaGCCGCCCTTA
CAaggttgaggccgggggttgaccctgggagCGGCGGTGGTCCCGGGTTCGAATCCCGGC
GGGCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK