The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0573
Genome IDCP000505
Search identical group
Phylum/ClassThermoproteota
SpeciesThermofilum pendens Hrk 5 [CP000505]
Start position on genome 477850
End posion on genome 477946
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gaggaaatgt
tRNA gene sequence
GGGCCCGTAGCGCAGTCAGGAAGCGCGGCGGCCTTCTAAGCCGCAGGTCCCGGGTTCGAA
TCCCGGCGGGCCCGCCA
Downstream region at tRNA end position
gtgcacacgt
Secondary structure (Cloverleaf model)
>At0573	Arg	TCT
                   t      GCCA gtgcacacgt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      T G A        A      | | | | |     G
    C       C G C G       C C G G G     C
    A       | | | |                 T T
    G       G C G C
      G A A        G     AGGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    C - G
                  C*      A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTAGCGCAGTCAGGAAGCGCGGCGGCCacgcccgcggggcgccgcatTTCTAAG
CCGCAGGTCCCGGGTTCGAATCCCGGCGGGCCCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK