The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0575
Genome IDCP000505
Search identical group
Phylum/ClassThermoproteota
SpeciesThermofilum pendens Hrk 5 [CP000505]
Start position on genome 536447
End posion on genome 536563
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
atctttttag
tRNA gene sequence
GCCGGGGTGGCCGAGCGGACCAAGGCGGTGGACTCGAGATCCACTGCCCGTTAAGGGTGC
CCGGGTTCGAATCCCGGCCCCGGCGCCA
Downstream region at tRNA end position
ttctctgcct
Secondary structure (Cloverleaf model)
>At0575	Ser	CGA
                   g      GCCA ttctctgcct
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     G G C C C     A
      C G A        G      | | | | |     G
    G       G C C G       C C G G G     C
    G         | | |                 T T
    A       A G G C
      C C A        G     TGCCCGTTAAGGGTGC
                    G - C
                    T - A
                    G - C
                    G - C
                    A - T
                  C*      A
                  T       G
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGGGGTGGCCGAGCGGACCAAGGCGGTGGACacttggagccacacTCGAGatctgtcc
gcgaggcATCCACTGCCCGTTAAGGGTGCCCGGGTTCGAATCCCGGCCCCGGCGCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK