The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0582
Genome IDCP000505
Search identical group
Phylum/ClassThermoproteota
SpeciesThermofilum pendens Hrk 5 [CP000505]
Start position on genome 764492
End posion on genome 764613
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
ttttctggca
tRNA gene sequence
GGGCCGGTCGTCTAGTGGGAGGATACCGCCTTCGCAAGGCGGAGGTCCCGGGTTCGAATC
CCGGCCGGTCCACCA
Downstream region at tRNA end position
cttctcatgt
Secondary structure (Cloverleaf model)
>At0582	Ala	CGC
                   a      ACCA cttctcatgt
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
        G A        C      | | | | |     G
      T     T C T G       C C G G G     C
      G     + | | +                 T T
      G     G G A T
        G A        A     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  T       A
                  T       A
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCGGTCGTCTAGTGGGAGGATtgcctctcccctcgaACCGCCTTCGCAAGGgtcgcg
taagggggcttcgatcccgagagcggCGGAGGTCCCGGGTTCGAATCCCGGCCGGTCCAC
CA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK