The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0615
Genome IDAE000782
Search identical group
Phylum/ClassEuryarchaeota
SpeciesArchaeoglobus fulgidus DSM 4304 [AE000782]
Start position on genome 964112
End posion on genome 964183
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
aaaggttcaa
tRNA gene sequence
GGGCTCGTAGCTCAGCGGGAGAGCGCCGCCTTCGCGAGGCGGAGGCCGCGGGTTCAAATC
CCGCCGAGTCCAtgt
Downstream region at tRNA end position
tttttctttt
Secondary structure (Cloverleaf model)
>At0615	Ala	CGC
                   a      Atgt tttttctttt
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C G C C C     A
        G A        A      | | | | |     A
      C     C T C G       G C G G G     C
      G     | | | |                 T T
      G     G A G C
        G A        G     AGGCC
                    C - G
                    C - G
                    G - C
                    C - G
                    C - G
                  T       A
                  T       G
                    C G C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTAGCTCAGCGGGAGAGCGCCGCCTTCGCGAGGCGGAGGCCGCGGGTTCAAATC
CCGCCGAGTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK