The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0630
Genome IDAE000782
Search identical group
Phylum/ClassEuryarchaeota
SpeciesArchaeoglobus fulgidus DSM 4304 [AE000782]
Start position on genome 558013
End posion on genome 557941
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gactttatga
tRNA gene sequence
AGCCCCGTGGTGTAGCGGTCAATCATGCGGGCCTTTGGAGCCCGCGACCGGGGTTCGAAT
CCCCGCGGGGCTAtgt
Downstream region at tRNA end position
ctaaaatcag
Secondary structure (Cloverleaf model)
>At0630	Gln	TTG
                   a      Atgt ctaaaatcag
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G C C C C     A
      C G A        G      | | | | |     G
    G       T G T G       C G G G G     C
    G         | | +                 T T
    T       T C A T
      C A A        G     CGAC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
AGCCCCGTGGTGTAGCGGTCAATCATGCGGGCCTTTGGAGCCCGCGACCGGGGTTCGAAT
CCCCGCGGGGCTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK