The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0636
Genome IDAE000782
Search identical group
Phylum/ClassEuryarchaeota
SpeciesArchaeoglobus fulgidus DSM 4304 [AE000782]
Start position on genome 1142830
End posion on genome 1142756
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
ctacccttaa
tRNA gene sequence
GGGCCCGTGGCTCAGCATGGATAGAGCGACGGCCTTCTAAGCCGTAGATCGCGGGTTCAA
ATCCCGCCGGGTCCGctc
Downstream region at tRNA end position
caatctaaag
Secondary structure (Cloverleaf model)
>At0636	Arg	TCT
                   a      Gctc caatctaaag
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C C C     A
    A C G A        G      | | | | |     A
  T         C T C G       G C G G G     C
  G         | | | |                 T T
  G         G A G C
    A T A          G     AGATC
                    A - T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCCCGTGGCTCAGCATGGATAGAGCGACGGCCTTCTAAGCCGTAGATCGCGGGTTCAA
ATCCCGCCGGGTCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK