The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0641
Genome IDAE000782
Search identical group
Phylum/ClassEuryarchaeota
SpeciesArchaeoglobus fulgidus DSM 4304 [AE000782]
Start position on genome 1537568
End posion on genome 1537496
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
accactccaa
tRNA gene sequence
GGGCTCGTGGTCTAGCGGTTATGACGTCGCCCTTACAAGGCGGAGATCGCCGGTTCGAAT
CCGGCCGAGCCCAttt
Downstream region at tRNA end position
ttgttttgaa
Secondary structure (Cloverleaf model)
>At0641	Val	TAC
                   a      Attt ttgttttgaa
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     C G G C C     A
      C G A        G      | | | | |     G
    G       T C T G       G C C G G     C
    G         | | |                 T T
    T       T G A C
      T A          G     AGATC
                    T + G
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTGGTCTAGCGGTTATGACGTCGCCCTTACAAGGCGGAGATCGCCGGTTCGAAT
CCGGCCGAGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK