The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0654
Genome IDCP000780
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoregula boonei 6A8 [CP000780]
Start position on genome 692471
End posion on genome 692543
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
atcgtcgagc
tRNA gene sequence
ACCCCCGTAGTGTAGCGGTCAATCATGCAGGACTTTGGATCCGGCGACACCAGTTCGAAT
CTGGTCGGGGGTAtat
Downstream region at tRNA end position
ccgttatcag
Secondary structure (Cloverleaf model)
>At0654	Gln	TTG
                   c      Atat ccgttatcag
                     A - T
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T G G T C     A
      C G A        A      | | | | |     G
    G       T G T G       A C C A G     C
    G         | | +                 T T
    T       T C A T
      C A A        G     CGAC
                    C - G
                    A   G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T T G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
ACCCCCGTAGTGTAGCGGTCAATCATGCAGGACTTTGGATCCGGCGACACCAGTTCGAAT
CTGGTCGGGGGTA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK