The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0671
Genome IDCP000780
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoregula boonei 6A8 [CP000780]
Start position on genome 2466900
End posion on genome 2466984
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
aaaaaccggt
tRNA gene sequence
GCCGAGGTAGTCTAGCCCGGGAAGGCGGTAGCCTCGAAAGCTACTGGCGCTTCGCGCCTC
GGGAGTTCAAATCTCCCCCTCGGCGttc
Downstream region at tRNA end position
ttttaaaaac
Secondary structure (Cloverleaf model)
>At0671	Ser	CGA
                   t      Gttc ttttaaaaac
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C C C T C     A
      C G A        A      | | | | |     A
    C       T C T G       G G G A G     C
    C       | | + |                 T T
    G       A G G C
      G G A        G     TGGCGCTTCGCGCCTC
                    G - C
                    T - A
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    C G A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCGAGGTAGTCTAGCCCGGGAAGGCGGTAGCCTCGAAAGCTACTGGCGCTTCGCGCCTC
GGGAGTTCAAATCTCCCCCTCGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK