The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0679
Genome IDCP000780
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoregula boonei 6A8 [CP000780]
Start position on genome 637065
End posion on genome 636994
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gtaggttatc
tRNA gene sequence
GGGCTCGTGGTCTAGCGGTATGACGTCGCCCTTACACGGCGAAGGTCACCGGTTCGAATC
CGGTCGGGCCCAtct
Downstream region at tRNA end position
cctctctttt
Secondary structure (Cloverleaf model)
>At0679	Val	TAC
                   c      Atct cctctctttt
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     G - C          T A
                    T     T G G C C     A
        G A        G      | | | | |     G
      C     T C T G       A C C G G     C
      G       | | |                 T T
      G     T G A C
        T A        G     AGGTC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGCTCGTGGTCTAGCGGTATGACGTCGCCCTTACACGGCGAAGGTCACCGGTTCGAATC
CGGTCGGGCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK