The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0688
Genome IDCP000780
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoregula boonei 6A8 [CP000780]
Start position on genome 1899112
End posion on genome 1899040
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
gtaccaaaga
tRNA gene sequence
GCCCAGGTAGTGTAGCGGCCTATCATGATTGCCTGTCACGCAATCGACTCGGATTCGAAT
TCCGACCTGGGCGttt
Downstream region at tRNA end position
acaacgtttt
Secondary structure (Cloverleaf model)
>At0688	Asp	GTC
                   a      Gttt acaacgtttt
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     G - C
                     G - C          T A
                    T     A G C C T     A
      C G A        A      | | | | |     G
    G       T G T G       T C G G A     C
    G         | | +                 T T
    C       T C A T
      C T A        G     CGAC
                    A - T
                    T - A
                    T - A
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCAGGTAGTGTAGCGGCCTATCATGATTGCCTGTCACGCAATCGACTCGGATTCGAAT
TCCGACCTGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK