The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0691
Genome IDCP000780
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoregula boonei 6A8 [CP000780]
Start position on genome 2002199
End posion on genome 2002126
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ttactttcca
tRNA gene sequence
GGGTTCGTAGCTCAGTTCGGTAGAGCGCCTGGCTTTTAACCAGGTGGTCGGGGGTTCAAA
TCCCTCCGGGCCCGtta
Downstream region at tRNA end position
ccacgaccaa
Secondary structure (Cloverleaf model)
>At0691	Lys	TTT
                   a      Gtta ccacgaccaa
                     G - C
                     G - C
                     G - C
                     T + G
                     T + G
                     C - G
                     G - C          T A
                    T     C T C C C     A
      T G A        A      | + | | |     A
    T       C T C G       G G G G G     C
    C       | | | |                 T T
    G       G A G C
      G T A        G     TGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGTTCGTAGCTCAGTTCGGTAGAGCGCCTGGCTTTTAACCAGGTGGTCGGGGGTTCAAA
TCCCTCCGGGCCCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK