The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0758
Genome IDAY596297
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloarcula marismortui ATCC 43049 [AY596297, AY596298]
Start position on genome 2063268
End posion on genome 2063341
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
ggtggagtac
tRNA gene sequence
GGGTCCGTGGTCTAGTTGGTTATGACGTGGCCTTTACAAGGCCGAGGCCGGTGGTTCGAA
TCCGCCCGGACCCAtcc
Downstream region at tRNA end position
tgcgacgaac
Secondary structure (Cloverleaf model)
>At0758	Val	TAC
                   c      Atcc tgcgacgaac
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     C - G
                     G - C          T A
                    T     C C G C C     A
      T G A        G      | | + | |     G
    T       T C T G       G G T G G     C
    G         | | |                 T T
    G       T G A C
      T T A        G     AGGCC
                    T + G
                    G - C
                    G - C
                    C - G
                    C - G
                  T       A
                  T       A
                    T A C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGTCCGTGGTCTAGTTGGTTATGACGTGGCCTTTACAAGGCCGAGGCCGGTGGTTCGAA
TCCGCCCGGACCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK