The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0760
Genome IDAY596297
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloarcula marismortui ATCC 43049 [AY596297, AY596298]
Start position on genome 2175970
End posion on genome 2176166
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tgcaacgaag
tRNA gene sequence
GCCCGGATGGTGTAGTGGCCCATCATACGACCCTGTCACGGTCGTGACGCGGGTTCAAAT
CCCGCTCCGGGCGttc
Downstream region at tRNA end position
ctattgtgaa
Secondary structure (Cloverleaf model)
>At0760	Asp	GTC
                   g      Gttc ctattgtgaa
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C
                     A - T          T A
                    T     C G C C C     A
      T G A        G      | | | | |     A
    G       T G T G       G C G G G     C
    G         | | +                 T T
    C       T C A T
      C C A        A     TGAC
                    C - G
                    G - C
                    A - T
                    C - G
                    C - G
                  C       C
                  T       A *
                    G T C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCCCGGATGGTGTAGTGGCCCATCATACGACCCTGTCAcggtcgtgacgcgggttcaaat
cccgctccgggcgttcctattgcaaccaaactggcgagcgccatgcggtgtgtgctcgca
gtctgcccggatggtgtagtggcccatcatacgaccctgtcaCGGTCGTGACGCGGGTTC
AAATCCCGCTCCGGGCG
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK